ID: 1133346143_1133346147

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1133346143 1133346147
Species Human (GRCh38) Human (GRCh38)
Location 16:5071857-5071879 16:5071892-5071914
Sequence CCTCATGCTTGGTCCTGCTGGCG CTGCCGCTGCTGCTGCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 111} {0: 1, 1: 6, 2: 37, 3: 174, 4: 803}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!