ID: 1133365202_1133365206

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1133365202 1133365206
Species Human (GRCh38) Human (GRCh38)
Location 16:5203700-5203722 16:5203715-5203737
Sequence CCAGCTTCGGCTCGGCATCAGAA CATCAGAAGGAGACCGTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 87, 2: 18, 3: 18, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!