ID: 1133417789_1133417803

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1133417789 1133417803
Species Human (GRCh38) Human (GRCh38)
Location 16:5619811-5619833 16:5619852-5619874
Sequence CCGTGAAGGCAGTCAGACCTGGG GGGGGCTCACTTCCTTCTCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!