ID: 1133484192_1133484195

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1133484192 1133484195
Species Human (GRCh38) Human (GRCh38)
Location 16:6202745-6202767 16:6202791-6202813
Sequence CCTCCCACGTTCTTTATGTAATT TTTCATTTTGTTTCTGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 168} {0: 1, 1: 4, 2: 157, 3: 2742, 4: 21870}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!