ID: 1133491079_1133491084

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1133491079 1133491084
Species Human (GRCh38) Human (GRCh38)
Location 16:6268814-6268836 16:6268860-6268882
Sequence CCCTGTTCCTCCAACAGAGAACA CAGTCTTCCCGCAGTATCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 257} {0: 1, 1: 0, 2: 3, 3: 43, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!