ID: 1133492753_1133492754

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1133492753 1133492754
Species Human (GRCh38) Human (GRCh38)
Location 16:6286581-6286603 16:6286622-6286644
Sequence CCTTAATAAGTGTGGTTGTTACT GACTTCTCCATAGCCTTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115} {0: 1, 1: 0, 2: 0, 3: 19, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!