ID: 1133507385_1133507390

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1133507385 1133507390
Species Human (GRCh38) Human (GRCh38)
Location 16:6425456-6425478 16:6425494-6425516
Sequence CCATTTCTGTGGGCTTGGGATTA TGTATAAGGGTCAGTCTTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 174} {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!