ID: 1133518642_1133518648

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1133518642 1133518648
Species Human (GRCh38) Human (GRCh38)
Location 16:6534687-6534709 16:6534718-6534740
Sequence CCTTTGCATTTTTTCTGCTGGGG CAGAATGCAAAGAGGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 296} {0: 1, 1: 1, 2: 10, 3: 158, 4: 1115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!