ID: 1133520816_1133520819

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1133520816 1133520819
Species Human (GRCh38) Human (GRCh38)
Location 16:6554902-6554924 16:6554921-6554943
Sequence CCAGAGTATGCTTTTTCTGCCAG CCAGCTGGAGAATTTGACCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 164} {0: 1, 1: 0, 2: 1, 3: 12, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!