ID: 1133550872_1133550873

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1133550872 1133550873
Species Human (GRCh38) Human (GRCh38)
Location 16:6853477-6853499 16:6853494-6853516
Sequence CCTACAGTGTGGTGCTCGAGGAC GAGGACAATCCCTGTCTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78} {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!