ID: 1133583390_1133583400

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1133583390 1133583400
Species Human (GRCh38) Human (GRCh38)
Location 16:7167859-7167881 16:7167912-7167934
Sequence CCCTCTGCGAAAAAAGTGTGCCA GTGCTTGTCTGGGGATGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 135} {0: 1, 1: 0, 2: 5, 3: 25, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!