ID: 1133592157_1133592162

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1133592157 1133592162
Species Human (GRCh38) Human (GRCh38)
Location 16:7256296-7256318 16:7256338-7256360
Sequence CCTCACCTCCACAGTCAGCGAGC CATTCCTACCAGAAGTTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 203} {0: 1, 1: 0, 2: 1, 3: 22, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!