ID: 1133598852_1133598856

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1133598852 1133598856
Species Human (GRCh38) Human (GRCh38)
Location 16:7319592-7319614 16:7319628-7319650
Sequence CCATGCTTTTCCTGGGCCTCAGA TCGAGGCGAGATTTAGAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 55, 4: 483} {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!