ID: 1133603208_1133603210

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1133603208 1133603210
Species Human (GRCh38) Human (GRCh38)
Location 16:7360304-7360326 16:7360333-7360355
Sequence CCAAACTGTGGTCAACTGAAAAC TCTGAGAAGATCAGAAATGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 137} {0: 1, 1: 0, 2: 0, 3: 20, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!