ID: 1133608750_1133608754

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1133608750 1133608754
Species Human (GRCh38) Human (GRCh38)
Location 16:7413444-7413466 16:7413477-7413499
Sequence CCAGAAACTTTGCATTTCTCACA TGAGGTCAACACTACCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 51, 3: 405, 4: 1603} {0: 1, 1: 0, 2: 2, 3: 16, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!