ID: 1133612353_1133612365

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1133612353 1133612365
Species Human (GRCh38) Human (GRCh38)
Location 16:7445333-7445355 16:7445380-7445402
Sequence CCCGCTACTCCTCTCTTAATCTG TTATGCACCAGCTCCATTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 198} {0: 1, 1: 0, 2: 2, 3: 14, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!