ID: 1133631802_1133631808

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1133631802 1133631808
Species Human (GRCh38) Human (GRCh38)
Location 16:7629118-7629140 16:7629148-7629170
Sequence CCATGGGACATTCCTTCAGGTAG GGCCCTGGGCTGCTTCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 159} {0: 1, 1: 0, 2: 6, 3: 51, 4: 529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!