ID: 1133636121_1133636125

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1133636121 1133636125
Species Human (GRCh38) Human (GRCh38)
Location 16:7667452-7667474 16:7667487-7667509
Sequence CCAGCATGTTCTGATGAGTGGAA TTCGTTTTTAAAAGAGATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136} {0: 1, 1: 0, 2: 7, 3: 76, 4: 667}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!