ID: 1133690812_1133690818

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1133690812 1133690818
Species Human (GRCh38) Human (GRCh38)
Location 16:8213243-8213265 16:8213274-8213296
Sequence CCCCTGAGAGCCGGGTGCGGTGG TGTGATCCCAGCATTTTGGAAGG
Strand - +
Off-target summary No data {0: 10, 1: 936, 2: 28275, 3: 332342, 4: 266203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!