ID: 1133690816_1133690823

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1133690816 1133690823
Species Human (GRCh38) Human (GRCh38)
Location 16:8213253-8213275 16:8213284-8213306
Sequence CCGGGTGCGGTGGCTTGCACTTG GCATTTTGGAAGGCTGAGGCGGG
Strand - +
Off-target summary No data {0: 135, 1: 5471, 2: 77120, 3: 203106, 4: 329783}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!