ID: 1133705412_1133705414

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1133705412 1133705414
Species Human (GRCh38) Human (GRCh38)
Location 16:8350060-8350082 16:8350095-8350117
Sequence CCAGTATTGTTGGAGCATTTAAT TCCCATAGCTGGTTGATTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 167} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!