ID: 1133738731_1133738736

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1133738731 1133738736
Species Human (GRCh38) Human (GRCh38)
Location 16:8635253-8635275 16:8635291-8635313
Sequence CCGGCACGGGGCTCGCTAGCATC GCACGGACCGTTTATTGTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 37} {0: 1, 1: 0, 2: 0, 3: 2, 4: 7}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!