ID: 1133770254_1133770262

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1133770254 1133770262
Species Human (GRCh38) Human (GRCh38)
Location 16:8863611-8863633 16:8863629-8863651
Sequence CCAGCCTCTCATGGCCCATCTGG TCTGGGCTGAAGCCAAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 277} {0: 1, 1: 0, 2: 0, 3: 35, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!