ID: 1133770257_1133770263

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1133770257 1133770263
Species Human (GRCh38) Human (GRCh38)
Location 16:8863615-8863637 16:8863632-8863654
Sequence CCTCTCATGGCCCATCTGGGCTG GGGCTGAAGCCAAGCTGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 225} {0: 1, 1: 0, 2: 4, 3: 38, 4: 383}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!