ID: 1133826242_1133826246

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1133826242 1133826246
Species Human (GRCh38) Human (GRCh38)
Location 16:9280692-9280714 16:9280738-9280760
Sequence CCAGGGGACATTTGGCCATATCT CTTGCTGCTGGCATATGTAGTGG
Strand - +
Off-target summary {0: 3, 1: 35, 2: 314, 3: 790, 4: 1355} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!