ID: 1133826244_1133826247

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1133826244 1133826247
Species Human (GRCh38) Human (GRCh38)
Location 16:9280707-9280729 16:9280739-9280761
Sequence CCATATCTAGAGACATTTTTGGT TTGCTGCTGGCATATGTAGTGGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 35, 3: 95, 4: 251} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!