ID: 1133834305_1133834311

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1133834305 1133834311
Species Human (GRCh38) Human (GRCh38)
Location 16:9352329-9352351 16:9352376-9352398
Sequence CCACAATCACTGCACTCTGTCTT CACACCACAGTGCAGCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 13, 3: 71, 4: 366} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!