ID: 1133881565_1133881575

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1133881565 1133881575
Species Human (GRCh38) Human (GRCh38)
Location 16:9787401-9787423 16:9787442-9787464
Sequence CCACCCTCTACCCCACTTCGGGT TGCACCAATGCATGCCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180} {0: 1, 1: 0, 2: 1, 3: 11, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!