ID: 1133901142_1133901143

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1133901142 1133901143
Species Human (GRCh38) Human (GRCh38)
Location 16:9976239-9976261 16:9976257-9976279
Sequence CCATGGCATGACTACTATGTGAG GTGAGTCTGTGTTCTTTAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 111, 4: 605} {0: 1, 1: 0, 2: 4, 3: 32, 4: 780}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!