ID: 1133902155_1133902162

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1133902155 1133902162
Species Human (GRCh38) Human (GRCh38)
Location 16:9986963-9986985 16:9986994-9987016
Sequence CCCGAGTTTCCTTCCAGCACCAC AATCTCTGGATATGGTACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 271} {0: 1, 1: 1, 2: 2, 3: 29, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!