ID: 1133905168_1133905175

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1133905168 1133905175
Species Human (GRCh38) Human (GRCh38)
Location 16:10015825-10015847 16:10015868-10015890
Sequence CCTCATTAAACCATGTGGTAGGG CACTGTAATCCCAGCTCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 88} {0: 2, 1: 383, 2: 9650, 3: 333211, 4: 353572}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!