|
Left Crispr |
Right Crispr |
| Crispr ID |
1133909338 |
1133909347 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:10050727-10050749
|
16:10050770-10050792
|
| Sequence |
CCCAACCCCGGTCTGTGGAAAAA |
CCCTGGTGCCAAAAAGATTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 19, 2: 128, 3: 297, 4: 640} |
{0: 67, 1: 1195, 2: 1695, 3: 1238, 4: 840} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|