ID: 1133915591_1133915594

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1133915591 1133915594
Species Human (GRCh38) Human (GRCh38)
Location 16:10106705-10106727 16:10106738-10106760
Sequence CCACGGACTTTGGGGAAGTTGGC CTAGAGAAAAAAGGAGAATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113} {0: 1, 1: 1, 2: 5, 3: 77, 4: 1009}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!