ID: 1133915591_1133915595

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1133915591 1133915595
Species Human (GRCh38) Human (GRCh38)
Location 16:10106705-10106727 16:10106742-10106764
Sequence CCACGGACTTTGGGGAAGTTGGC AGAAAAAAGGAGAATAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113} {0: 1, 1: 0, 2: 16, 3: 176, 4: 1821}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!