ID: 1133931696_1133931699

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1133931696 1133931699
Species Human (GRCh38) Human (GRCh38)
Location 16:10238092-10238114 16:10238110-10238132
Sequence CCAACGCAATCCATCCTGGATAT GATATTTTTTCGCAAAGCAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!