|
Left Crispr |
Right Crispr |
| Crispr ID |
1133950535 |
1133950541 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:10387984-10388006
|
16:10388015-10388037
|
| Sequence |
CCTCCTCCCTCCGGGTTCAAGTG |
GCCTCAGCCTTGCAAGTAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 17, 2: 730, 3: 13121, 4: 63383} |
{0: 76, 1: 3323, 2: 93958, 3: 206548, 4: 245473} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|