ID: 1133966784_1133966793

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1133966784 1133966793
Species Human (GRCh38) Human (GRCh38)
Location 16:10537514-10537536 16:10537543-10537565
Sequence CCCACTGCACTCCAGCCCCACTG TCTCCGTCCCTCCTGTCACAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 28, 3: 229, 4: 2056} {0: 1, 1: 0, 2: 2, 3: 24, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!