ID: 1133974614_1133974625

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1133974614 1133974625
Species Human (GRCh38) Human (GRCh38)
Location 16:10591715-10591737 16:10591755-10591777
Sequence CCCCTAACCAGAGAGAGGAGGCA CTCAGAGCTGAAAAAATACTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!