ID: 1133993406_1133993409

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1133993406 1133993409
Species Human (GRCh38) Human (GRCh38)
Location 16:10728226-10728248 16:10728244-10728266
Sequence CCAGATTGTTTTGAGACAGCTGC GCTGCTTGAGCTCCACGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!