|
Left Crispr |
Right Crispr |
| Crispr ID |
1133997728 |
1133997741 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:10761127-10761149
|
16:10761165-10761187
|
| Sequence |
CCATGATCCAATCACCTCCCACC |
CTGTAGGGATGTAGGGATGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1936, 1: 4532, 2: 7496, 3: 10022, 4: 10633} |
{0: 1, 1: 0, 2: 1, 3: 54, 4: 418} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|