|
Left Crispr |
Right Crispr |
| Crispr ID |
1134001405 |
1134001415 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:10785885-10785907
|
16:10785912-10785934
|
| Sequence |
CCTTTGTCACCACCGGACTTTGG |
CCTACAGGTGGTGTTGAGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 7, 2: 14, 3: 31, 4: 231} |
{0: 7, 1: 20, 2: 21, 3: 29, 4: 214} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|