|
Left Crispr |
Right Crispr |
| Crispr ID |
1134001778 |
1134001790 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:10788505-10788527
|
16:10788548-10788570
|
| Sequence |
CCAGCCTCAACACCACCCGTAAG |
ACAAAGGAATGAGAAGAGACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 17, 2: 24, 3: 25, 4: 123} |
{0: 23, 1: 18, 2: 19, 3: 67, 4: 652} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|