|
Left Crispr |
Right Crispr |
| Crispr ID |
1134005675 |
1134005679 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:10817773-10817795
|
16:10817788-10817810
|
| Sequence |
CCACCTCCTCAGAGAGGCCCTCC |
GGCCCTCCATGGCTGCACTAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 16, 2: 66, 3: 244, 4: 941} |
{0: 1, 1: 0, 2: 0, 3: 8, 4: 116} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|