ID: 1134006580_1134006584

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1134006580 1134006584
Species Human (GRCh38) Human (GRCh38)
Location 16:10822239-10822261 16:10822252-10822274
Sequence CCTACCCACACTGGTCTTGGCCC GTCTTGGCCCCTGAAGGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!