ID: 1134019804_1134019807

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1134019804 1134019807
Species Human (GRCh38) Human (GRCh38)
Location 16:10913634-10913656 16:10913650-10913672
Sequence CCTCACAGTTAAAAATAAAACTC AAAACTCTGGCCAGGCGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 68, 4: 750} {0: 2, 1: 48, 2: 392, 3: 2879, 4: 12236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!