ID: 1134023720_1134023731

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1134023720 1134023731
Species Human (GRCh38) Human (GRCh38)
Location 16:10939415-10939437 16:10939447-10939469
Sequence CCTTCCAGGTCCTCCATGGTATG CACCTCACTGACCTTTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172} {0: 1, 1: 0, 2: 2, 3: 19, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!