ID: 1134037151_1134037160

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1134037151 1134037160
Species Human (GRCh38) Human (GRCh38)
Location 16:11039901-11039923 16:11039933-11039955
Sequence CCACAGGGCCACGCAGTTGTAGG CCACTGGGAGCCTGAGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99} {0: 1, 1: 1, 2: 5, 3: 36, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!