ID: 1134037153_1134037158

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1134037153 1134037158
Species Human (GRCh38) Human (GRCh38)
Location 16:11039909-11039931 16:11039932-11039954
Sequence CCACGCAGTTGTAGGAAGCAGAC CCCACTGGGAGCCTGAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 79} {0: 1, 1: 0, 2: 4, 3: 59, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!