ID: 1134046999_1134047009

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1134046999 1134047009
Species Human (GRCh38) Human (GRCh38)
Location 16:11108366-11108388 16:11108410-11108432
Sequence CCAAGGCAGTCCAGGAGCATGGA ACCAGGGAGTTAAACCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 211} {0: 1, 1: 0, 2: 1, 3: 4, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!