ID: 1134057797_1134057804

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1134057797 1134057804
Species Human (GRCh38) Human (GRCh38)
Location 16:11181285-11181307 16:11181301-11181323
Sequence CCCCTGGCATCCAGAGGAAGAGC GAAGAGCCAGGAGTGTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 214} {0: 1, 1: 0, 2: 3, 3: 51, 4: 606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!